After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NMNAT1 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

NMNAT, also known as NMNAT1, is a member of the Nicotinamide-nucleotide adenylyltransferases. It is widely expressed with high levels in skeletal muscle, heart, liver and kidney. NMNAT appears to have the ability to protect against axonal degeneration following mechanical or toxic insults. The coenzyme NAD and its derivatives are involved in hundreds of metabolic redox reactions and are utilized in protein ADP-ribosylation, histone deacetylation, and in some Ca(2+) signaling pathways. NMNAT enzyme is vital for NAD biosynthesis, catalyzing the condensation of nicotinamide mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) with the AMP moiety of ATP to form NAD or NaAD.

References
  • Sugano S. et al., 1994, Gene. 138 (1-2): 171-4.
  • Saccucci F. et al., 2001, J Biol Chem. 276 (1): 406-12.
  • Hennig K. et al., 2001, FEBS Lett. 492 (1-2): 95-100.
  • Images
    • Human NMNAT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"