Quick Order

Human CBLB natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CBLB cDNA Clone Product Information
RefSeq ORF Size:2949bp
cDNA Description:Full length Clone DNA of Homo sapiens Cas-Br-M (murine) ecotropic retroviral transforming sequence b.
Gene Synonym:RNF56, FLJ36865, FLJ41152, Nbla00127, DKFZp779A0729, DKFZp779F1443, DKFZp686J10223, CBLB
Restriction Site:KpnI + XhoI (5.5kb + 2.95kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations: 1272 C/T, 1341A/C and 2613 T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG11435-M-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions