Quick Order

Human TLR6 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TLR6 cDNA Clone Product Information
NCBI RefSeq:NM_006068.2
RefSeq ORF Size:2391bp
cDNA Description:Full length Clone DNA of Homo sapiens toll-like receptor 6.
Gene Synonym:CD286, TLR6
Restriction Site:NheI + XhoI (5.5kb + 2.39kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 1083 C/G and 1263 A/G not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TLR6 Gene Plasmid Map
Human TLR6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.