Quick Order

Human PMP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PMP2cDNA Clone Product Information
cDNA Size:399
cDNA Description:ORF Clone of Homo sapiens peripheral myelin protein 2 DNA.
Gene Synonym:P2, MP2, FABP8, M-FABP, PMP2
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 186 A/G not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

Myelin P2 protein, also known as PMP2, is a cytosolic protein found primarily in peripheral nerves. It Belongs to the calycin superfamily. Fatty-acid binding protein (FABP) family. PMP2 is a small, basic, and cytoplasmic lipid binding protein of peripheral myelin. It is similar in amino acid sequence and tertiary structure to fatty acid binding proteins found in the liver, adipocytes, and intestine, its expression is limited to the nervous system. PMP2 is detected only in myelin-producing cells of the central and peripheral nervous systems, the oligodendrocytes and Schwann cells, respectively. PMP2 may play a role in lipid transport protein in Schwann cells. It forms a beta-barrel structure that accommodates hydrophobic ligands in its interior.

  • Hayasaka, K. et al., 1993, Genomics. 18 (2): 244-8.
  • Polverini, E. et al., 2006, J Struct Biol. 153 (3): 253-63.
  • Gould,R.M. et al., 2008, Neuron Glia Biol. 4 (2):137-52.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human PMP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items