Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human SULT1A3 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human SULT1A3 Gene Plasmid Map
Human SULT1A3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

SULT1A3 belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. They are different in their tissue distributions and substrate specificities while their gene structure (number and length of exons) is similar. SULT1A3 gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. It is the most centromeric of the four sulfotransferase genes. Exons of this gene overlap with exons of a gene that encodes a protein containing GIY-YIG domains (GIYD1). SULT1A3 is expressed in liver, colon, kidney, lung, brain, spleen, small intestine, placenta and leukocyte. SULT1A3 is a sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of phenolic monoamines (neurotransmitters such as dopamine, norepinephrine and serotonin) and phenolic and catechol drugs.

References
  • Dajani R, et al. (1999) Kinetic properties of human dopamine sulfotransferase (SULT1A3) expressed in prokaryotic and eukaryotic systems: comparison with the recombinant enzyme purified from Escherichia coli. Protein Expr. Purif. 16 (1): 11-8.
  • Dajani R, et al. (2000) X-ray crystal structure of human dopamine sulfotransferase, SULT1A3. J. Biol. Chem. 274 (53): 37862-8.
  • Yasuda S, et al. (2011) Sulfation of chlorotyrosine and nitrotyrosine by human lung endothelial and epithelial cells: role of the human SULT1A3. Toxicol Appl Pharmacol. 251 (2): 104-9.
  • Hildebrandt MA, et al. (2004) Human SULT1A3 pharmacogenetics: gene duplication and functional genomic studies. Biochem Biophys Res Commun. 321 (4): 870-8.
  • Lu JH, et al. (2005) Crystal structure of human sulfotransferase SULT1A3 in complex with dopamine and 3'-phosphoadenosine 5'-phosphate. Biochem Biophys Res Commun. 335 (2): 417-23.
  • Images
    • Human SULT1A3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"