After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human PTMA ORF mammalian expression plasmid, Flag tag

DatasheetReviewsRelated ProductsProtocols
Human PTMA cDNA Clone Product Information
NCBI RefSeq:NM_001099285.1
RefSeq ORF Size:336bp
cDNA Description:Full length Clone DNA of Homo sapiens prothymosin, alpha with Flag tag.
Gene Synonym:TMSA, MGC104802
Restriction Site:KpnI + XhoI (5.4kb + 0.39kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PTMA Gene Plasmid Map
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

PTMA (prothymosin, alpha, N-GST chimera) is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin a1. Thymosins are named becaues they were originally isolated from the thymus. But now in many other tissues, thymosins also can be detected. Thymosins have diverse biological activities, and two in particular, thymosins a1 and _4, have potentially important uses in medicine, some of which have already progressed from the laboratory to the clinic. In general, PTMA is associated with cellular proliferation and carcinogenesis (Eschenfeldt et al., 1986), cellular and viral transcription (Cotter et al., 2000), protection against apoptosis and chromatin remodelling (Karetsou et al., 1998). PTMA may have a dual role both intracellulary and extracellulary. In relation to diseases, thymosins have been categorized as biological response modifiers. Thymosin a1 is derived from PTMA. For animals that lack thymus glands, thymosin a1 is responsible for the activity of that preparation in restoring immune function.

  • Manrow RE, et al. (1992) The human prothymosin alpha gene family contains several processed pseudogenes lacking deleterious lesions. Genomics. 13(2):319-31.
  • Wara DW, et al. (1975) Thymosin activity in patients with cellular immunodeficiency. N Engl J Med. 292(2):70-4.
  • Garaci E, et al. (2007) Thymosin alpha 1: from bench to bedside. Ann N Y Acad Sci. 1112:225-34.
  • Goldstein AL, et al. (2009) From lab to bedside: emerging clinical applications of thymosin alpha 1. Expert Opin Biol Ther. 9(5):593-608.
  • Size / Price
    Catalog: HG11407-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.