Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human CMBL cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human CMBL Gene Plasmid Map
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Carboxymethylenebutenolidase (CMBL), also known as 4-carboxymethylenebut-2-en-4-olide lactonohydrolase, maleylacetate enol- lactonase, dienelactone hydrolase, and carboxymethylene butenolide hydrolase, is a hydrolase specially belonging to the family of hydrolases. It maily acts on carboxylic ester bonds. CMBL is a human homolog of Pseudomonas dienelactone hydrolase involved in the bacterial halocatechol degradation pathway. The ubiquitous expression of human CMBL gene transcript in various tissues was observed. CMBL was demonstrated to be the primary olmesartan medoxomil (OM) bioactivating enzyme in the liver and intestine. The recombinant human CMBL expressed in mammalian cells was clearly shown to activate OM. The recombinant CMBL also converted other prodrugs having the same ester structure as OM, faropenem medoxomil and lenampicillin, to their active metabolites. CMBL exhibited a unique sensitivity to chemical inhibitors, thus, being distinguishable from other known esterases.  

References
  • Ishizuka T, et al. (2010) Human Carboxymethylenebutenolidase as a Bioactivating Hydrolase of Olmesartan Medoxomil in Liver and Intestine. The Journal of Biological Chemistry. 285: 11892-902.
  • Schmidt E, et al. (1980) Chemical structure and biodegradability of halogenated aromatic compounds. Conversion of chlorinated muconic acids into maleoylacetic acid. Biochem J. 192 (1): 339-47.
  • Images
    • Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"