Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NMNAT2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human NMNAT2 Gene Plasmid Map
Human NMNAT2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

NMNAT2, also known as NMNAT-2, belongs to the nicotinamide mononucleotide adenylyltransferase (NMNAT) enzyme family. NMNAT is a central enzyme in NAD+ biosynthesis, transferring the adenylyl moiety of ATP to nicotinamide mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) resulting in the formation of NAD+ or NaAD+ and the release of pyrophosphate. NMNAT2 is predominantly expressed in human pancreas, insulinoma as well as in the brain, especially in the cerebrum, cerebellum, occipital lobe, frontal lobe, temporal lobe and putamen. Immunofluorescence microscopy localized endogenous NMNAT2 to the Golgi apparatus in human cell line. Endogenous NMNAT2 seem to be a labile axon survival factor, because specific depletion of NMNAT2 is sufficient to induce Wallerian-like degeneration of uninjured axons which endogenous NMNAT1 and NMNAT3 cannot prevent. Thus endogenous NMNAT2 represents an exciting new therapeutic target for axonal disorders.

References
  • Ljungberg MC. et al., 2012, Hum Mol Genet. 21 (2): 251-67.
  • Seki N. et al., 1998, DNA Res. 4 (5): 345-9.
  • Raffaelli N. et al., 2002, Biochem Biophys Res Commun. 297 (4): 835-40.
  • Sood R. et al., 2001, Genomics. 73 (2): 211-22.
  • Images
    • Human NMNAT2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"