After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FLRT1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human FLRT1 Gene Plasmid Map
Human FLRT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

The three fibronectin leucine-rich repeat transmembrane (FLRT) proteins contain 10 leucine-rich repeats (LRR), a type III fibronectin (FN) domain, followed by the transmembrane region, and a short cytoplasmic tail. FLRT1 is expressed in kidney and brain, which is a target for tyrosine phosphorylation mediated by FGFR1 and implicate a non-receptor Src family kinase (SFK). All FLRTs can interact with FGFR1 and FLRTs can be induced by the activation of FGF signalling by FGF-2. The phosphorylation state of FLRT1, which is itself FGFR1 dependent, may play a critical role in the potentiation of FGFR1 signalling and may also depend on a SFK-dependent phosphorylation mechanism acting via the FGFR. This is consistent with an 'in vivo' role for FLRT1 regulation of FGF signalling via SFKs. Furthermore, the phosphorylation-dependent futile cycle mechanism controlling FGFR1 signalling is concurrently crucial for regulation of FLRT1-mediated neurite outgrowth. FLRT1, FLRT2 and FLRT3 are members of the fibronectin leucine rich transmembrane protein (FLRT) family. They may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. FLRT3 shares 55% amino acid sequence identity with FLRT1.

  • Lacy SE, et al. (1999) Identification of FLRT1, FLRT2, and FLRT3: a novel family of transmembrane leucine-rich repeat proteins. Genomics. 62(3): 417-26.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Maretto S, et al. (2008) Ventral closure, headfold fusion and definitive endoderm migration defects in mouse embryos lacking the fibronectin leucine-rich transmembrane protein FLRT3. Dev Biol. 318(1): 184-93.
  • Wheldon LM, et al. (2010) Critical role of FLRT1 phosphorylation in the interdependent regulation of FLRT1 function and FGF receptor signalling. PLoS One. 5(4): e10264.
  • Images
    • Human FLRT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.