After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human FLRT1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FLRT1cDNA Clone Product Information
cDNA Size:2025
cDNA Description:ORF Clone of Homo sapiens fibronectin leucine rich transmembrane protein 1 DNA.
Gene Synonym:MGC21624, FLRT1
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for four point mutations: 246 T/C, 1548 C/T, 1893 A/G and 1965 C/T not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

The three fibronectin leucine-rich repeat transmembrane (FLRT) proteins contain 10 leucine-rich repeats (LRR), a type III fibronectin (FN) domain, followed by the transmembrane region, and a short cytoplasmic tail. FLRT1 is expressed in kidney and brain, which is a target for tyrosine phosphorylation mediated by FGFR1 and implicate a non-receptor Src family kinase (SFK). All FLRTs can interact with FGFR1 and FLRTs can be induced by the activation of FGF signalling by FGF-2. The phosphorylation state of FLRT1, which is itself FGFR1 dependent, may play a critical role in the potentiation of FGFR1 signalling and may also depend on a SFK-dependent phosphorylation mechanism acting via the FGFR. This is consistent with an 'in vivo' role for FLRT1 regulation of FGF signalling via SFKs. Furthermore, the phosphorylation-dependent futile cycle mechanism controlling FGFR1 signalling is concurrently crucial for regulation of FLRT1-mediated neurite outgrowth. FLRT1, FLRT2 and FLRT3 are members of the fibronectin leucine rich transmembrane protein (FLRT) family. They may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. FLRT3 shares 55% amino acid sequence identity with FLRT1.

  • Lacy SE, et al. (1999) Identification of FLRT1, FLRT2, and FLRT3: a novel family of transmembrane leucine-rich repeat proteins. Genomics. 62(3): 417-26.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Maretto S, et al. (2008) Ventral closure, headfold fusion and definitive endoderm migration defects in mouse embryos lacking the fibronectin leucine-rich transmembrane protein FLRT3. Dev Biol. 318(1): 184-93.
  • Wheldon LM, et al. (2010) Critical role of FLRT1 phosphorylation in the interdependent regulation of FLRT1 function and FGF receptor signalling. PLoS One. 5(4): e10264.
  • Size / Price
    List Price: $445.00  (Save $130.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human FLRT1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items