Quick Order

Text Size:AAA

Human LRRTM4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LRRTM4cDNA Clone Product Information
cDNA Size:1773
cDNA Description:ORF Clone of Homo sapiens leucine rich repeat transmembrane neuronal 4 DNA.
Gene Synonym:FLJ12568, MGC120633, MGC120636, LRRTM4
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 202T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

Leucine-rich repeat transmembrane neuronal protein 4, also known as LRRTM4, is a single-pass type I  membrane protein which belongs to the LRRTM family. LRRTM4 is expressed in the limb mesenchyme, neural tube, caudal mesoderm and in three distinct regions of the head. LRRTM4 may play a role in the development and maintenance of the vertebrate nervous system. Leucine-rich repeat containing proteins are involved in protein-protein interactions and they regulate numerous cellular events during nervous system development and disease. Human and mouse LRRTMs are highly conserved, and orthologous genes exist in other vertebrates but not in invertebrates. LRRTM mRNAs are predominantly expressed in the nervous system and that each LRRTM possesses a specific, partially nonoverlapping expression pattern. The structure and expression profile of LRRTM mRNAs suggest that they may have a role in the development and maintenance of the vertebrate nervous system. All LRRTMs, except LRRTM4, are located in the introns of different alpha-catenin genes, suggesting coevolution of these two gene families.

  • Laurén,J. et al., 2003, Genomics 81 (4):411-21.
  • Clark HF. et al.,2003, Genome Res. 13: 2265-70.
  • Haines,BP. et al., 2007,Gene Expr Patterns  7 (1-2): 23-9.
  • Size / Price
    List Price: $395.00  (Save $80.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human LRRTM4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items