Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human HIST2H2BE cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human HIST2H2BE Gene Plasmid Map
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. Histone proteins exhibit two levels of diversity: 1. evolutionary diversity between species and 2. subtype diversity in a class(H1, H2A, H2B, H3 or H4) within a species. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone H2B proteins have been studied in a variety of species and is easily detecred in most species. The reversible ubiquitylation of histone H2B has long been implicated in transcriptional activation and gene silencing. Phosphorylation of H2B serine 32 occurs in normal cycling and mitogen-stimulated cells. Notably, this phosphorylation is elevated in skin cancer cell lines and tissues compared with normal counterparts. HIST2H2BE is a member of the histone H2B family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif.

  • Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.
  • Collart D, et al. (1993). A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.
  • Marzluff WF, et al. (2002). The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.
  • Images
    • Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.