Quick Order

Human FAM3B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FAM3BcDNA Clone Product Information
Gene_bank_ref_id:NM_058186.3
cDNA Size:708
cDNA Description:ORF Clone of Homo sapiens family with sequence similarity 3, member B DNA.
Gene Synonym:2-21, ORF9, PANDER, PRED44, C21orf11, C21orf76, FAM3B
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 396T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Pancreatic derived factor, also known as FAM3B, is an islet-specific secreted cytokine specifically expressed at high levels in the islets of Langerhans of the endocrine pancreas. FAM3B protein is present in alpha- and beta- cells of pancreatic islets, insulin-secreting beta-TC3 cells, and glucagon-secreting alpha-TC cells. FAM3B causes apoptosis of beta-cells as assessed by electron microscopy, annexin Ⅴ fluorescent staining, and flow-cytometric terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling assay. FAM3B activated caspase-3 while not affect cytosolic Ca2+ levels or nitric oxide levels. Hense, FAM3B may have a role in the process of pancreatic?-cell apoptosis of primary islet and cell lines. FAM3B secretion is regulated by glucose and other insulin secretagogues. This islet-specific secreted cytokine is secreted from both pancreatic alpha- and beta- cells. Glucose stimulates FAM3B secretion dose dependently in beta- cell lines and primary islets but not in alpha-cells. It is likely cosecreted with insulin via the same regulatory mechanisms and structure and conformation is vital for FAM3B secretion.

References
  • Cao X, et al. (2003) Pancreatic-derived factor (FAM3B), a novel islet cytokine, induces apoptosis of insulin-secreting beta-cells. Diabetes. 52(9): 2296-303.
  • Yang J, et al. (2005) Mechanisms of glucose-induced secretion of pancreatic-derived factor (PANDER or FAM3B) in pancreatic beta-cells. Diabetes. 54(11): 3217-28.
  • Xu W, et al. (2005) Interferon-gamma-induced regulation of the pancreatic derived cytokine FAM3B in islets and insulin-secreting betaTC3 cells. Mol Cell Endocrinol. 240(1-2): 74-81.
  • Size / Price
    Catalog:HG11338-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human FAM3B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"