After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BLMH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BLMHcDNA Clone Product Information
Gene_bank_ref_id:NM_000386.2
cDNA Size:1368
cDNA Description:ORF Clone of Homo sapiens bleomycin hydrolase DNA.
Gene Synonym:BH, BMH, BLMH
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 603 C/G not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

The papain superfamily member bleomycin hydrolase (BLMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution. The only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The papain superfamily member bleomycin hydrolase (BLMH) is a neutral cysteine protease with structural similarity to a 20S proteasome. Bleomycin (BLM), a clinically used glycopeptide anticancer agent. BLMH is an essential protectant against BLM-induced death and has an important role in neonatal survival and in maintaining epidermal integrity. Sequencing revealed several putative sites phosphorylated by different types of protein kinases, but no signal sequence, transmembrane domain, N-linked glycosylation site or DNA-binding motif.

References
  • Takeda A, et al. (1996) Cloning and Analysis of cDNA Encoding Rat Bleomycin Hydrolase, a DNA-Binding Cysteine Protease. J Biochem. 120 (2): 353-9.
  • Lefterov IM, et al. (2000) Human bleomycin hydrolase regulates the secretion of amyloid precursor protein. The FASEB Journal. 14(12): 1837-47.
  • Brmme D, et al. (1996) Human Bleomycin Hydrolase: Molecular Cloning, Sequencing, Functional Expression, and Enzymatic Characterization. Biochemistry. 35 (21): 6706-14.
  • Size / Price
    Catalog:HG11333-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human BLMH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"