Quick Order

Human FUT10 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FUT10cDNA Clone Product Information
Gene_bank_ref_id:NM_032664.3
cDNA Size:1440
cDNA Description:ORF Clone of Homo sapiens fucosyltransferase 10 (alpha (1,3) fucosyltransferase) DNA.
Gene Synonym:MGC11141, FUT10
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
References
  • Breton, C. et al., 1998, Glycobiology. 8 (1): 87-94.
  • Oriol, R. et al., 1999, Glycobiology. 9 (4): 323-34.
  • de Vries, T. et al., 2001, Glycobiology. 11 (10): 119R-128R.
  • Baboval, T. et al., 2002, Mamm. Genome. 13: 538-541.
  • Size / Price
    Catalog:HG11327-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human FUT10 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"