Quick Order

Human HSPD1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HSPD1cDNA Clone Product Information
Gene_bank_ref_id:NM_002156.4
cDNA Size:1722
cDNA Description:ORF Clone of Homo sapiens heat shock 60kDa protein 1 (chaperonin) DNA.
Gene Synonym:HLD4, CPN60, GROEL, HSP60, HSP65, SPG13, HuCHA60, HSPD1
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations 69 T/C and 273 A/G not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human HSPD1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name
Background

HSPD1, also known as HSP60, is a member of the chaperonin family. HSPD1 may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. It may also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. HSPD1 gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13.Defects in HSPD1 are a cause of spastic paraplegia autosomal dominant type 13 (SPG13). Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Defects in HSPD1 are the cause of leukodystrophy hypomyelinating type 4 (HLD4); also called mitochondrial HSP60 chaperonopathy or MitCHAP-60 disease. HLD4 is a severe autosomal recessive hypomyelinating leukodystrophy. HSPD1 is cinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurrs within the first two decades of life.

References
  • Hansen J J, et al. (2002) Hereditary spastic paraplegia SPG13 is associated with a mutation in the gene encoding the mitochondrial chaperonin Hsp60. Am J Hum Genet. 70: 1328-32.
  • Magen D, et al. (2008) Mitochondrial Hsp60 chaperonopathy causes an autosomal-recessive neurodegenerative disorder linked to brain hypomyelination and leukodystrophy. Am J Hum Genet. 83: 30-42.
  • Venner TJ, et al. (1990) Nucleotide sequences and novel structural features of human and Chinese hamster hsp60 (chaperonin) gene families. DNA Cell Biol. 9 (8): 545-52.
  • Size / Price
    Catalog:HG11322-M-N
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    Images
    • Human HSPD1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"