Quick Order

Human SOCS3 ORF mammalian expression plasmid, His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SOCS3 cDNA Clone Product Information
Gene_bank_ref_id:NM_003955.3
RefSeq ORF Size:677bp
cDNA Description:Full length Clone DNA of Homo sapiens suppressor of cytokine signaling 3 with His tag.
Gene Synonym:CIS3, SSI3, ATOD4, Cish3, SSI-3, SOCS-3, MGC71791, SOCS3
Species:Human
Vector:pCMV/hygro-His
Plasmid:pCMV-SOCS3-10his
Restriction Site:KpnI + XhoI (5.5kb + 0.71kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Suppressor of cytokine signaling 3, also known as SOCS-3, Cytokine-inducible SH2 protein 3, CIS-3, STAT-induced STAT inhibitor 3, SOCS3 and CIS3, is a protein which is widely expressed with high expression in heart, placenta, skeletal muscle, peripheral blood leukocytes, fetal and adult lung, and fetal liver and kidney. SOCS3 / CIS3 contains one SH2 domain and one SOCS box domain. SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS3 / CIS3 is involved in negative regulation of cytokines that signal through the JAK / STAT pathway. SOCS3 / CIS3 inhibits cytokine signal transduction by binding to tyrosine kinase receptors including gp130, LIF, erythropoietin, insulin, IL12, GCSF and leptin receptors. Binding to JAK2 inhibits its kinase activity. SOCS3 / CIS3 suppresses fetal liver erythropoiesis. It regulates onset and maintenance of allergic responses mediated by T-helper type 2 cells. SOCS3 / CIS3 regulates IL-6 signaling. SOCS3 / CIS3 interacts with multiple activated proteins of the tyrosine kinase signaling pathway including IGF1 receptor, insulin receptor and JAK2. SOCS3 / CIS3 could be used as a possible therapeutic agent for treating rheumatoid arthritis.

References
  • Hoertner M., et al., 2002, Eur. J. Biochem. 269:2516-26.
  • Yamamoto K., et al., 2003, Biochem. Biophys. Res. Commun. 310 : 1188-93.
  • Kamura T., et al., 2004, Genes Dev. 18:3055-65.
  • Okamura A., et al., 2004, Blood 103:2997-3004.
  • Ekelund E., et al., 2006, Am. J. Hum. Genet. 78:1060-5.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"