Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SAA4 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human SAA4 Gene Plasmid Map
Human SAA4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

SAA4 is a member of the SAA family.SAA proteins are family of apolipoproteins of high density lipoprotein (HDL). They can be separated into two distinct groups. First group (SAA1, SAA2, and SAA3) consists of acute phase reactant whose expression level increase in the blood in a response to trauma, infection, inflammation, and neoplasia. These acute phase SAAs associates with HDL during inflammation and remodel the HDL particle by displacing Apo-A1. The second distinct group consists of SAA4 and SAA5 which exist as the minor apolipoproteins on HDL, but this group of SAA constitutes more than 90% of all the SAA during homeostasis, and it is thought to play a role in the normal functioning of the HDL particle. SAA4 is a constitutively expressed protein which expressed only in humans and mice.It is connected almost completely with lipoproteins of the high density range. The physiological function of SAA4 is unknown, and its serum concentration has no association with those of other major apolipoproteins.

  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Murphy CL, et al. (2009) AA amyloidosis associated with a mutated serum amyloid A4 protein. Mol Med. Amyloid. 16(2):84-8.
  • Prakash T, et al. (2010) Expression of conjoined genes: another mechanism for gene regulation in eukaryotes. PLoS One. 5(10):e13284.
  • Images
    • Human SAA4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items