Quick Order

Text Size:AAA

Human SAA4 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SAA4 cDNA Clone Product Information
RefSeq ORF Size:393bp
cDNA Description:Full length Clone DNA of Homo sapiens serum amyloid A4, constitutive with Flag tag.
Gene Synonym:CSAA, C-SAA, SAA4
Restriction Site:KpnI + XhoI (5.4kb + 0.44kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SAA4 Gene Plasmid Map
Human SAA4 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

SAA4 is a member of the SAA family.SAA proteins are family of apolipoproteins of high density lipoprotein (HDL). They can be separated into two distinct groups. First group (SAA1, SAA2, and SAA3) consists of acute phase reactant whose expression level increase in the blood in a response to trauma, infection, inflammation, and neoplasia. These acute phase SAAs associates with HDL during inflammation and remodel the HDL particle by displacing Apo-A1. The second distinct group consists of SAA4 and SAA5 which exist as the minor apolipoproteins on HDL, but this group of SAA constitutes more than 90% of all the SAA during homeostasis, and it is thought to play a role in the normal functioning of the HDL particle. SAA4 is a constitutively expressed protein which expressed only in humans and mice.It is connected almost completely with lipoproteins of the high density range. The physiological function of SAA4 is unknown, and its serum concentration has no association with those of other major apolipoproteins.

  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Murphy CL, et al. (2009) AA amyloidosis associated with a mutated serum amyloid A4 protein. Mol Med. Amyloid. 16(2):84-8.
  • Prakash T, et al. (2010) Expression of conjoined genes: another mechanism for gene regulation in eukaryotes. PLoS One. 5(10):e13284.
  • Size / Price
    Catalog: HG11311-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions