Quick Order

Text Size:AAA

Human ENPP2 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ENPP2 cDNA Clone Product Information
RefSeq ORF Size:2592bp
cDNA Description:Full length Clone DNA of Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 with Flag tag.
Restriction Site:KpnI + XhoI (5.4kb + 2.64kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ENPP2 Gene Plasmid Map
Human ENPP2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

ENPP2 (Ectonucleotide pyrophosphatase/phosphodiesterase family member 2), also referred as Autotaxin, is a secreted enzyme encoded by the ENPP2 gene. This gene product stimulates the motility of tumor cells, has angiogenic properties, and its expression is upregulated in several kinds of carcinomas. The Autotaxin protein is important for generating the lipid signaling molecule lysophosphatidic acid (LPA), which is a potent mitogen, which facilitates cell proliferation and migration, neurite retraction, platelet aggregation, smooth muscle contraction, actin stress formation and cytokine and chemokine secretion. ATX has been found to catalyze the formation of cyclic phosphatidic acid (cPA), which have antitumor role by antimitogenic regulation of cell cycle, inhibition of cancer invasion and metastasis. LPA receptors and ATX are upregulated in numerous cancer cell types and show expression patterns that correlate with tumor cell invasiveness. Thus, Autotaxin has recently emerged as an attractive target for the development of anti-cancer chemotherapeutics. In addition, Serum ATX activity was found to be enhanced in relation to hepatic fibrosis in chronic liver disease due to hepatitis virus C infection.

  • Tania M, et al. (2010) Autotaxin: a protein with two faces. Biochem Biophys Res Commun. 401(4): 493-7.
  • Ikeda H, et al. (2009) Significance of serum autotaxin activity in gastrointestinal disease. Rinsho Byori. 57(5): 445-9.
  • Parrill AL, et al. (2008) Autotaxin inhibition: challenges and progress toward novel anti-cancer agents. Anticancer Agents Med Chem. 8(8): 917-23.
  • Pradere J.P, et al. (2007) Secretion and lysophospholipase D activity of autotaxin by adipocytes are controlled by N-glycosylation and signal peptidase. Biochim Biophys Acta. 1771: 93-102.
  • Boucher J, et al. (2005) Potential involvement of adipocyte insulin resistance in obesity-associated up-regulation of adipocyte lysophospholipase D/autotaxin expression. Diabetologia. 48: 569-77.
  • Size / Price
    Catalog: HG11308-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions