Quick Order

Human GPNMB transcript variant 2 ORF mammalian expression plasmid, Flag tag

DatasheetReviewsRelated ProductsProtocols
Human GPNMB cDNA Clone Product Information
NCBI RefSeq:NM_002510.2
RefSeq ORF Size:1683bp
cDNA Description:Full length Clone DNA of Homo sapiens glycoprotein (transmembrane) nmb, transcript variant 2 with Flag tag.
Gene Synonym:NMB, HGFIN, GPNMB
Restriction Site:KpnI + XhoI (5.4kb + 1.73kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1497 T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human GPNMB Gene Plasmid Map
Human GPNMB transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human GPNMB Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human GPNMB transcript variant 2 natural ORF mammalian expression plasmid, Flag tag
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

GPNMB belongs to the PMEL / NMB family, also known as Osteoactivin and Hematopoietic growth factor-inducible neurokinin 1 ( HGFIN ), is a transmembrane glycoprotein that is expressed in numerous cells, including osteoclasts, macrophages, dendritic cells, and tumor cells. It is suggested to influence osteoblast maturation, cell adhesion and migration. GPNMB protein acts as a downstream mediator of BMP-2 effects on osteoblast differentiation and function. GPNMB participates in bone mineralization, and functions as a negative regulator of inflammation in macrophages. Osteoactivin is expressed at high levels in normal and inflammatory liver macrophages suggesting a significant role in acute liver injury. The early-phase upregulation of Osteoactivin expression in the tubular epithelium in response to renal injury might play a role in triggering renal interstitial fibrosis via activation of matrix metalloproteinase expression and collagen remodeling in rats. Osteoactivin as a protein that is expressed in aggressive human breast cancers and is capable of promoting breast cancer metastasis to bone.

  • Pahl MV. et al., 2010, Clin J Am Soc Nephrol. 5(1): 56-61.
  • Abdelmagid SM. et al., 2008, Exp Cell Res. 314(13): 2334-51.
  • Haralanova-Ilieva B. et al., 2005, J Hepatol. 242(4): 565-72.
  • Abdelmagid SM. et al., 2007, J Cell Physiol. 210(1): 26-37.
  • Furochi H. et al., 2007, J Med Invest. 54(3-4): 248-54.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.