After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AKR1B1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human AKR1B1 Gene Plasmid Map
Human AKR1B1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Aldose reductase (AKR1B1) belongs to the aldo/keto reductase superfamily. AKR1B1 is a NADPH-dependent aldo-keto reductase best known as the rate-limiting enzyme of the polyol pathway. Expression of AKR1B1 was the highest in lens and retina. It is the first enzyme in the polyol pathway through which glucose is converted to sorbitol which is important for the function of various organs in the body, and has been implicated in the etiology of diabetic complications. AKR1B1 is quite abundant in the collecting tubule cells and thought to provide protection against hypertonic environment. Some human tissues contain AKR1B1 as well as AKR1B10, a closely related member of the aldo-keto reductase superfamily. 

  • Huang SP, et al. (2010) Aldo-Keto Reductases in the Eye. Journal of Ophthalmology. 326 (3): 625-36.
  • Aida K, et al. (2000) Disruption of Aldose Reductase Gene (Akr1b1) Causes Defect in Urinary Concentrating Ability and Divalent Cation Homeostasis. Biochemical and Biophysical Research Communications.277 (2): 281-6.
  • Liao CS, et al. (2009) Regulation of AKR1B1 by thyroid hormone and its receptors. Molecular and Cellular Endocrinology. 307 (1-2): 109-17.
  • Baba SP, et al. (2009) Posttranslational glutathiolation of aldose reductase (AKR1B1): A possible mechanism of protein recovery from S-nitrosylation. Chemico-Biological Interactions. 178 (1-3): 250-8.
  • Images
    • Human AKR1B1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items