Quick Order

Human TXNDC17 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TXNDC17 cDNA Clone Product Information
Gene_bank_ref_id:NM_032731.3
RefSeq ORF Size:372bp
cDNA Description:Full length Clone DNA of Homo sapiens thioredoxin domain containing 17.
Gene Synonym:TRP14, TXNL5, MGC14353, TXNDC17
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-TXNDC17
Restriction Site:KpnI + XhoI (5.5kb + 0.37kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
References
  • Holmgren A. (1985) Thioredoxin. Annu Rev Biochem. 54: 237-71.
  • Holmgren A. (1995) Thioredoxin structure and mechanism: conformational changes on oxidation of the active-site sulfhydryls to a disulfide. Structure. 3 (3): 239-43.
  • Martin JL. (1995) Thioredoxin--a fold for all reasons. Structure. 3 (3): 245-50.
  • Size / Price
    Catalog: HG11288-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"