After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CTNNB1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CTNNB1cDNA Clone Product Information
cDNA Size:2346
cDNA Description:ORF Clone of Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa DNA.
Gene Synonym:CTNNB, FLJ25606, FLJ37923, DKFZp686D02253, CTNNB1
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HA Vector Information
Vector Name pCMV/hygro-HA
Vector Size 5684bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Schematic of pCMV/hygro-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human CTNNB1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged on other vectors
Related Products
Product nameProduct name

beta-Catenin, also known as CTNNB1, is a member of the armadillo family of proteins. These proteins have multiple copies of the so-called armadillo repeat domain, which is specialized for protein-protein binding. It is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. CTNNB1 also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, beta-Catenin binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Defects in beta-Catenin can cause colorectal cancer, pilomatrixoma (PTR), medulloblastoma, and ovarian cancer. CTNNB1 is a key dowstream component of the canonical Wnt signaling pathway. In the absence of Wnt, it forms a complex with AXIN1, AXIN2, APC, CSNK1A1 and GSK3B that promotes phosphorylation on N-terminal Ser and Thr residues and ubiquitination of CTNNB1 via BTRC and its subsequent degradation by the proteasome. In the presence of Wnt ligand, beta-Catenin is not ubiquitinated and accumulates in the nucleus, where it acts as a coactivator for transcription factors of the TCF/LEF family, leading to activate Wnt responsive genes. CTNNB1 is involved in the regulation of cell adhesion. The majority of beta-catenin is localized to the cell membrane and is part of E-cadherin/catenin adhesion complexes which are proposed to couple cadherins to the actin cytoskeleton.

  • Yang, et al. (2002) Linking β-catenin to androgen-signaling pathway. J Biol Chem. 277(13):11336-44.
  • Hino S, et al. (2005) Phosphorylation of β-Catenin by Cyclic AMP-Dependent Protein Kinase Stabilizes β-Catenin through Inhibition of Its Ubiquitination. Mol Cell Biol. 25(20):9063-72.
  • Liu X, et al. (2005) Rapid, Wnt-induced changes in GSK3beta associations that regulate beta-catenin stabilization are mediated by Galpha proteins. Curr Biol. 15(22):1989-97.
  • Kraus C, et al. (1994) Localization of the human β-catenin gene (CTNNB1) to 3p21: a region implicated in tumor development. Genomics. 23(1):272-4.
  • Size / Price
    List Price: $445.00  (Save $130.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human CTNNB1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
    Recently Viewed Items