After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD63 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human CD63 Gene Plasmid Map
Human CD63 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 63 (CD63) is a member of the CD family and the transmembrane 4 superfamily,also known as the tetraspanin family. CD63 is a cellular surface glycoprotein characterized by the presence of four bydrophobic domains. CD63 had functions in mediating signal transduction processes and then regulate variety of cellular processes such as cell proliferation, activation and motility. It has reported that CD63 protein associated with tumor progression and served as a blood platlet activation marker and the deficiency of this protein may be associated with Hermansky-Pudlak syndrome.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Radford KJ, et al. (1996) Associates with Transmembrane 4 Superfamily Members, CD9 and CD81, and with beta 1 Integrins in Human Melanoma. Biochemical Biophysical Research Communications. 222(1): 13-18.
  • Metzelaar MJ, et al. (1991) CD63 antigen, A novel lysosomal membrane glycoprotein, cloned by a screening procedure for intracellular antigens in eukaryotic cells. The journal of biological chemistry. 266: 3239-45.
  • Images
    • Human CD63 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items