After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACOX1 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Peroxisomal acyl-coenzyme A oxidase 1(ACOX1 or AOX) is the first enzyme of the fatty acid beta-oxidation pathway and belongs to the Acyl-CoA oxidase family. Human liver peroxisomes contain two acyl-CoA oxidases, namely, palmitoyl-CoA oxidase (ACOX1/AOX) and a branched chain acyl-CoA oxidase. The palmitoyl-CoA oxidase (ACOX1/AOX) oxidizes the CoA esters of straight chain fatty acids and prostaglandins and donates electrons directly to molecular oxygen, thereby producing H2O2. Human ACOX1/AOX is a protein of 661-amino acids, including the carboxyl-terminal sequence(Ser-Lys-Leu) known as a minimal peroxisome-targeting signal. Human ACOX1/AOX, the first and rate-limiting enzyme of the peroxisomal β-oxidation pathway, has two isoforms including ACOX1a and ACOX1b, transcribed from a single gene. The human ACOX1b isoform is more effective than the ACOX1a isoform in reversing the Acox1 null phenotype in the mouse partly because of the Substrate utilization differences.

References
  • Vluggens A, et al. (2010) Functional significance of the two ACOX1 isoforms and their crosstalks with PPAR alpha and RXR alpha. Laboratory Investigation. 90: 696-708.
  • Chu R, et al. (1995) Overexpression and characterization of the human peroxisomal acyl-CoA oxidase in insect cells. J Biol Chem. 270 (9): 4908-15.
  • Aoyama T, et al. (1994) Molecular cloning and functional expression of a human peroxisomal acyl-coenzyme A oxidase. Biochem Biophys Res Commun. 198 (3): 1113-8.
  • Images
    • Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"