Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TPST1 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Protein-tyrosine sulfotransferase 1, also known as Tyrosylprotein sulfotransferase 1 and TPST1, is a single-pass type I I membrane protein which belongs to the protein sulfotransferase family. Tyrosine O-sulfation is a common posttranslational modification of proteins in all multicellular organisms. This reaction is mediated by a Golgi enzyme activity called tyrosylprotein sulfotransferase (TPST) that catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to tyrosine residues within acidic motifs of polypeptides. Tyrosine O-sulfation has been shown to be important in protein-protein interactions in several systems. Tyrosine sulfation is mediated by one of two Golgi isoenzymes, called tyrosylprotein sulfotransferases (TPST-1 and TPST-2). A relatively small number of proteins are known to undergo tyrosine sulfation, including certain adhesion molecules, G-protein-coupled receptors, coagulation factors, serpins, extracellular matrix proteins, and hormones. TPST1 is a human tyrosylprotein sulfotransferase that uses 3'phosphoadenosine-5'phosphosulfate (PAPS) to transfer the sulfate moiety to proteins predominantly designated for secretion. TPST1 bears N-linked glycosyl residues exclusively at position Asn60 and Asn262. TPST1 and TPST2 have distinct biological roles that may reflect differences in their macromolecular substrate specificity.

References
  • Ouyang Y.-B.et al., 1998, Proc. Natl. Acad. Sci. USA. 95: 2896-901.
  • Ouyang,Y.B. et al., 2002,J Biol Chem. 277 (26):23781-7.
  • Hoffhines, A.J. et al., 2006, J Biol Chem. 281 (49):37877-87.
  • Goettsch,S. et al., 2006, J Mol Biol. 361 (3):436-49.
  • Westmuckett, A.D. et al., 2008, Gen Comp Endocrinol. 156 (1):145-53.
  • Images
    • Human TPST1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"