After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRDX2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Peroxiredoxin-2, also known as Natural killer cell-enhancing factor B, NKEF-B, Thiol-specific antioxidant protein, Thioredoxin peroxidase 1, Thioredoxin-dependent peroxide reductase 1, PRDX2 and NKEFB, is a cytoplasm protein which belongs to the ahpC / TSA family. Peroxiredoxin-2 / PRDX2 contains one thioredoxin domain. Peroxiredoxin-2 / PRDX2 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-2 / PRDX2 is not able to receive electrons from glutaredoxin. It may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-2 / PRDX2 might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2.

The Peroxiredoxins / Prx are a family of peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

References
  • Cha M.-K., et al., 1995,  Biochem. Biophys. Res. Commun. 217:900-7.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Chevallet M., et al., 2003, J. Biol. Chem. 278:37146-53.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Gauci S., et al., 2009, Anal. Chem. 81:4493-501.
  • Images
    • Human PRDX2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"