Quick Order

Human CDH13 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDH13cDNA Clone Product Information
Gene_bank_ref_id:NM_001257.3
cDNA Size:2142
cDNA Description:ORF Clone of Homo sapiens cadherin 13,H-cadherin(heart) DNA.
Gene Synonym:CDHH,
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 2076A/G not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

CDH13, also known as cadherin-13 and H Cadherin, is a member of the cadherin superfamily. CDH13 acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. CDH13 is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. CDH13 gene is hypermethylated in many types of cancer.

References
  • Hart AB. et al., 2012, PLoS One. 7 (8): e42646.
  • Xu J. et al., 2012, BMC Cancer. 12: 243.
  • Jo J. et al., 2012, Obesity (Silver Spring). 20 (8): 1683-7.
  • Size / Price
    Catalog:HG11249-M-N
    List Price: $345.00  (Save $30.00)
    Price:$315.00      [How to order]
    Availability5 business days
    Images
    • Human CDH13 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"