Quick Order

DatasheetReviewsRelated ProductsProtocols
Human PPM1G cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human PPM1G Gene Plasmid Map
Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Protein phosphatase 1G, also known as Protein phosphatase 1C, Protein phosphatase 2C isoform gamma, Protein phosphatase magnesium-dependent 1 gamma, PP2C-gamma, PPM1G and PPM1C, is a cytoplasm protein which belongs to the PP2C family. PPM1G / PP2C-gamma is widely expressed. It is most abundant in testis, skeletal muscle, and heart. Alternatively spliced transcript variants encoding the same protein have been described. PP2C family members are known to be negative regulators of cell stress response pathways.  PPM1G / PP2C-gamma is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. PPM1G / PP2C-gamma also plays a role in regulating cell cycle progression.

  • Travis S.M., et al., 1997, FEBS Lett. 412:415-9.
  • Molina H., et al., 2007, Proc. Natl. Acad. Sci. USA. 104: 2199-204.
  • Matsuoka S., et al., 2007, Science 316:1160-6.
  • Images
    • Human PPM1G Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.