Quick Order

Text Size:AAA

Human PPM1G ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PPM1G cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Protein phosphatase 1G, also known as Protein phosphatase 1C, Protein phosphatase 2C isoform gamma, Protein phosphatase magnesium-dependent 1 gamma, PP2C-gamma, PPM1G and PPM1C, is a cytoplasm protein which belongs to the PP2C family. PPM1G / PP2C-gamma is widely expressed. It is most abundant in testis, skeletal muscle, and heart. Alternatively spliced transcript variants encoding the same protein have been described. PP2C family members are known to be negative regulators of cell stress response pathways.  PPM1G / PP2C-gamma is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. PPM1G / PP2C-gamma also plays a role in regulating cell cycle progression.

  • Travis S.M., et al., 1997, FEBS Lett. 412:415-9.
  • Molina H., et al., 2007, Proc. Natl. Acad. Sci. USA. 104: 2199-204.
  • Matsuoka S., et al., 2007, Science 316:1160-6.