After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BIK cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

The BIN1 protein, which is encoded by the BIN1 gene, belongs to Myc-interacting protein family which is one of the nucleocytoplasmic adaptor proteins. The BIN1 protein can interact with the functionally critically Myc-box region at the N-terminal of the Myc oncoprotein, with a feature of tumor suppressor. Myc family proteins promote proliferation, growth, and apoptosis and, when deregulated, are profoundly involved in the genesis of an extraordinarily wide range of cancers. Although BIN1 is expressed in many normal cells, its levels were greatly reduced or undetectable in 14/27 carcinoma cell lines and 3/6 primary breast tumours. Deficits were functionally Although BIN1 is expressed in many normal cells, its levels were greatly reduced or undetectable in 14/27 carcinoma cell lines and 3/6 primary breast tumours. Deficits were functionally significant because ectopic expression of BIN1 inhibited the growth of tumour cells lacking endogenous message. We conclude that BIN1 is an MYC-interacting protein with features of a tumour suppressor.

Images
  • Human BIK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"