Quick Order

Human LCP2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LCP2 cDNA Clone Product Information
RefSeq ORF Size:1602bp
cDNA Description:Full length Clone DNA of Homo sapiens lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa).
Gene Synonym:SLP76, SLP-76, LCP2
Restriction Site:HindIII + XhoI (5.5kb + 1.6kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 564 G/A not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG11237-M-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions