Quick Order

Text Size:AAA

Human CHI3L1 / YKL40 ORF mammalian expression plasmid, His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CHI3L1 cDNA Clone Product Information
RefSeq ORF Size:1152bp
cDNA Description:Full length Clone DNA of Homo sapiens chitinase 3-like 1 (cartilage glycoprotein-39) with His tag.
Gene Synonym:GP39, ASRT7, YKL40, YYL-40, HC-gp39, HCGP-3P, FLJ38139, DKFZp686N19119, CHI3L1
Restriction Site:HindIII + XhoI (5.5kb + 1.18kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1092 T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Chitinase-3-like protein 1 (CHI3L1) is a secreted heparin-binding glycoprotein whose expression is associated with vascular smooth muscle cell migration. CHI3L1 is expressed at high levels in postconfluent nodular VSMC cultures and at low levels in subconfluent proliferating cultures. CHI3L1 is a tissue-restricted, chitin-binding lectin and member of glycosyl hydrolase family 18. In contrast to many other monocyto / macrophage markers, its expression is absent in monocytes and strong induced during late stages of human macrophage differentiation. Elevated levels of CHI3L1 are associated with disorders exhibiting increased connective tissue turnover, such as rheum atoid, arthritis, osteoarthritis, scleroderma, and cirrhosis of liver, but is produced in cartilage from old donors or patiens with osteoarthritis. CHI3L1 is abnormally expressed in the hippocampus of subjects with schizophrenia and may be involved in the cellular response to various environmental events that are reported to increase the risk of schizophrenia.

  • Zhao XZH, et al. (2007) Functional Variants in the Promoter Region of Chitinase 3-Like 1 (CHI3L1) and Susceptibility to Schizophrenia.The American Journal of Human Genetics. 80 (1): 12-18.
  • Rehli M, et al. (2003) Transcriptional Regulation of CHI3L1, a Marker Gene for Late Stages of Macrophage Differentiation . The Journal of Biological Chemistry. 278: 44058-67.
  • Nishikawa KC, et al. (2003) gp38k (CHI3L1) is a novel adhesion and migration factor for vascular cells. Experimental Cell Research. 287 (1): 79-87
  • Size / Price
    Catalog: HG11227-M-H
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions