Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CHIT1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human CHIT1 Gene Plasmid Map
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Chitotriosidase, also known as Chitinase-1 and CHIT1, is a member of the glycosyl hydrolase 18 family and Chitinase class II subfamily. It is a member of the mammalian chitinase family, structurally homologous to chitinases from other species, is synthesized and secreted by specifically activated macrophages. Chitotriosidase is a polymer of N-acetylglucosamine. Serum and plasma chitotriosidase activity is usually measured as the first step in diagnosis of Gaucher disease. Monitoring chitotriosidase activity is widely used during treatment of this pathology by enzyme replacement therapy. Its elevated plasma level reflects gradual intralysosomal accumulation in Gaucher cells (lipid-loaded macrophages). Macrophages overloaded by the enzyme accumulated in lysosomal material (lipids) were shown to secrete chitotriosidase; its increased expression was noted in several lysosomal storage diseases and atherosclerosis. In addition to lipid storage disorders, where Chit activity has longer been used as a marker of disease activity and therapeutic response, elevation of plasma Chit may occur in hematological disorders with storage of erythrocyte membrane breakdown products as thalassemia and different systemic infectious diseases sustained by fungi and other pathogens. Recently, increased Chit activity was demonstrated in CNS from patients with different neurological disorders. Chitotriosidase is believed to play a role in mechanisms of immunity and protection against chitin-containing pathogens.

  • Barone R, et al. (2007) Plasma chitotriosidase in health and pathology. Clin Lab. 53(5-6): 321-33.
  • Bargagli E, et al. (2008) Human chitotriosidase: a potential new marker of sarcoidosis severity. Respiration. 76(2): 234-8.
  • Korolenko TA, et al. (2010) Chitotriosidase of human macrophages and mammalian chitinases: biological functions and abnormalities in pathology. Vestn Ross Akad Med Nauk. (11): 39-45.
  • Images
    • Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items