Quick Order

Human Apolipoprotein H / APOH natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human APOH/B2G1 cDNA Clone Product Information
RefSeq ORF Size:1038bp
cDNA Description:Full length Clone DNA of Homo sapiens apolipoprotein H (beta-2-glycoprotein I).
Gene Synonym:BG, B2G1, APOH
Restriction Site:KpnI + XbaI (5.5kb + 1.04kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human APOH/B2G1 Gene Plasmid Map
Human Apolipoprotein H / APOH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Apolipoprotein H (APOH), also known as Beta-2-glycoprotein 1, Activated protein C-binding protein, B2GPI, and B2G1, is a glycoprotein synthesized by liver cells and it is present in the blood associated with plasma lipoproteins. It is an essential cofactor for the binding of certain antiphospholipid antibodies (APA) to anionic phospholipid. APOH binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. APOH may prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells. APOH appears to completely inhibit serotonin release by the platelets and prevents subsequent waves of the ADP-induced aggregation. The activity of APOH appears to involve the binding of agglutenating, negatively charged compounds, and inhibits agglutenation by the contact activation of the intrinsic blood coagulation pathway. APOH causes a reduction of the prothrombinase binding sites on platelets and reduces the activation caused by collagen when thrombin is present at physiological serum concentrations of APOH suggesting a regulatory role of APOH in coagulation. APOH plasma concentrations are strongly associated to metabolic syndrome alterations and vascular disease in type 2 diabetic and could be considered as a clinical marker of cardiovascular risk. APOH is found on several classes of lipoproteins, and is involved in the activation of lipoprotein lipase in lipid metabolism. This single-chain glycoprotein also has been implicated in several physiologic pathways including coagulation and the production of hypertension, which are related to the pathogenesis of primary cerebral hemorrhage (PICH).

  • Kamboh MI, et al. (1998) Genetics of apolipoprotein H (beta2-glycoprotein I) and anionic phospholipid binding. Lupus. 7 Suppl 2: S10-3.
  • Singh P, et al. (2002) Genetics of apolipoprotein H (beta2-glycoprotein I) polymorphism in India. Ann Hum Biol. 29(3): 247-55.
  • Xia J, et al. (2004) Apolipoprotein H gene polymorphisms and risk of primary cerebral hemorrhage in a Chinese population. Cerebrovasc Dis. 17(2-3): 197-203.
  • Chen Q, et al. (2006) Complete DNA sequence variation in the apolipoprotein H (beta-glycoprotein I) gene and identification of informative SNPs. Ann Hum Genet. 70(Pt 1): 1-11.
  • Leduc MS, et al. (2008) Comprehensive evaluation of apolipoprotein H gene (APOH) variation identifies novel associations with measures of lipid metabolism in GENOA. J Lipid Res. 49(12): 2648-56.
  • Size / Price
    Catalog: HG11221-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions