Quick Order

Human B4GALT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
B4GALT1cDNA Clone Product Information
cDNA Size:1197
cDNA Description:ORF Clone of Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 DNA.
Gene Synonym:GT1, GTB, GGTB2, B4GAL-T1, MGC50983, beta4Gal-T1, DKFZp686N19253, B4GALT1
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 597 C/T not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

Beta1,4-Galactosyltransferase-I (B4GALT1), one of seven beta1,4-galactosyltransferases, is an enzyme commonly found in the trans-Golgi complex that adds galactose to oligosaccharides. They have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. B4GALT1 gene directs production of B4GALT1 protein using either of two transcription start sites. The product of the smaller transcript serves the traditional biosynthetic role in the Golgi. This form also complexes with α-lactalbumin, a mammary-specific protein, to form lactose synthase. In addition to a biosynthetic role, the protein translated from the longer transcript appears on the plasma membranes of some cells where it serves as a signalling receptor in cell-matrix interactions such as sperm-egg binding.

  • Hennet T. (2002) The galactosyltransferase family. Cellular and Molecular Life Sciences. 59(7): 1081-95.
  • Landers EA, et al. (2009) Porcine 1, 4-Galactosyltransferase-I Sequence and Expression. Reproduction in Domestic Animals. 44(2): 228-34.
  • Amado M, et al. (2000) Identification and characterization of large galactosyltransferase gene families: galactosyltransferases for all functions. Biochim Biophys Acta. 1473 (1): 35-53.
  • Size / Price
    List Price: $395.00  (Save $100.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human B4GALT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items