After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SMYD3 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

SET and MYND domain-containing protein 3, also known as Zinc finger MYND domain-containing protein 1, SMYD3, and ZMYND, is a member of the histone-lysine methyltransferase family. SMYD3 contains one MYND-type zinc finger and one SET domain. SMYD3 is a histone H3 lysine-4-specific methyltransferase. It is expressed in skeletal muscles and testis. It is overexpressed in a majority of colorectal carcinoma (CRC) and hepatocellular carcinoma (HCC). SMYD3 plays an important role in transcriptional regulation in human carcinogenesis. It activates the transcription of a set of downstream genes. Of these downstream genes, there are several oncogenes and genes associated with cell adhesion (including those of N-Myc, CrkL, Wnt10b, L-selectin, CD31 and galectin-4), which have been shown to have effects on cell viability, adhesion, migration and metastasis. Increased SMYD3 expression is essential for the proliferation of breast cancer cells. SMYD3 may be a promising new target of therapeutic intervention for the treatment of cancers or other pathological processes associated with cell adhesion and migration.

References
  • Hamamoto, R. et al., 2006, Cancer Sci. 97 (2): 113-8.
  • Luo, XG. et al., 2007, J Biosci Bioeng. 103 (5): 444-50.
  • Wang, XQ. et al., 2007, Exp Oncol. 29 (1): 71-3.
  • Silva, FP. et al., 2008, Oncogene. 27 (19): 2686-92.
  • Images
    • Human SMYD3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"