After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human LAMP-1 / CD107a / LAMP1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LAMP1cDNA Clone Product Information
cDNA Size:1254
cDNA Description:ORF Clone of Homo sapiens lysosomal-associated membrane protein 1 DNA.
Gene Synonym:LAMPA, CD107a, LGP120, LAMP1
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutation: 6 G/T and 556 C/A not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human LAMP-1 / CD107a / LAMP1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged on other vectors
Related Products
Product nameProduct name

Lysosome-associated membrane glycoprotein 1, also known as CD107 antigen-like family member A, CD107a, and LAMP1, is a single-pass type I membrane protein which belongs to the LAMP family. CD107a is expressed largely in the endosome-lysosome membranes of cells, but is also found on the plasma membrane (1-2% of total LAMP1). LAMP1 has been implicated in a variety of cellular functions, including cancer metastasis. It has been proposed LAMP1 serves as a therapeutic agent for some cancers, as well as a marker for lysosomal storage disorders and different cell types such as cytotoxic T cells. LAMP2, also known as CD107b, may also play a role in tumor cell metastasis and functions in the protection, maintenance, and adhesion of the lysosome. Cell surface LAMP1 and LAMP2 have been shown to promote adhesion of human peripheral blood mononuclear cells (PBMC) to vascular endothelium, therefore they are possibly involved in the adhesion of PBMCs to the site of inflammation. LAMP-1 is a glycoprotein highly expressed in lysosomal membranes. The present study was initiated to test LAMP-1 mRNA and protein levels in post mortem frontal cortex (area 8) of Alzheimer's disease (AD) stages I-IIA/B and stages V-VIC of Braak and Braak, compared with age-matched controls. LAMP-1 occurred in microglia and multinucleated giant cells in one AD case in whom amyloid burden was cleared following betaA-peptide immunization. In addition, LAMP-1 has been suggested to be a cell surface receptor for a specific amelogenin isoform, leucine-rich amelogenin peptide or LRAP. LAMP-1 can serve as a cell surface binding site for amelogenin on dental follicle cells and cementoblasts.

  • Parkinson-Lawrence EJ, et al. (2005) Immunochemical analysis of CD107a (LAMP-1). Cell Immunol. 236(1-2): 161-6.
  • Barrachina M, et al. (2006) Lysosome-associated membrane protein 1 (LAMP-1) in Alzheimer's disease. Neuropathol Appl Neurobiol. 32(5): 505-16.
  • Zhang H, et al. (2010) Full length amelogenin binds to cell surface LAMP-1 on tooth root/periodontium associated cells. Arch Oral Biol. 55(6): 417-25.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human LAMP-1 / CD107a / LAMP1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged