Quick Order

Text Size:AAA

Human PRMT3 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human PRMT3 cDNA Clone Product Information
NCBI RefSeq:NM_005788.3
RefSeq ORF Size:1596bp
cDNA Description:Full length Clone DNA of Homo sapiens protein arginine methyltransferase 3.
Gene Synonym:HRMT1L3, PRMT3
Restriction Site:KpnI + XhoI (5.5kb + 1.6kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PRMT3 Gene Plasmid Map
Human PRMT3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Protein arginine methyltransferase 3, also known as PRMT3, is one of four type I  protein arginine methyltransferases (PRMT)  that in humans is encoded by the PRMT3 gene. Methylation of arginine residues is a widespread post-translational modification of proteins catalyzed by a small family of PRMTs. The modification appears to regulate protein functions and interactions that affect gene regulation, signalling and subcellular localization of proteins and nucleic acids. In human cells, the PRMT family consists of eight canonical members. PRMTs have been classified into two groups based on the end product. Certain PRMTs display different subcellular localization in different cell types, implicating cell- and tissue-specific mechanisms for regulating PRMT functions. PRMT3 is unique in that its N-terminus harbours a C2H2 zinc-finger domain that is proposed to confer substrate specificity. In addition, PRMT3 is the only type I  enzyme that is restricted to the cytoplasm. A large proportion of this cystosolic PRMT3 is found associated with ribosomes. It is tethered to the ribosomes through its interaction with rpS2, which is also its substrate.

  • Swiercz, R. et al., 2005, Biochem J. 386 (Pt 1): 85-91.
  • Iwasaki, H., 2008, Biochem Biophys Res Commun  372 (2): 314-9.
  • Lei, NZ. et al., 2009, Nucleic acids Res 37 (3): 832-48.
  • Fan, Q. et al., 2009, Biochem J. 421 (1): 107-18.
  • Herrmann, FJ. et al., 2009, Cell Sci. 122 (Pt 5): 667-77.
  • Kölbel, K. J Biol Chem 2009, 284 (13): 8274-82.
  • Size / Price
    Catalog: HG11211-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.