Quick Order

Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SETD7cDNA Clone Product Information
Gene_bank_ref_id:NM_030648.2
cDNA Size:1101
cDNA Description:ORF Clone of Homo sapiens SET domain containing (lysine methyltransferase) 7 DNA.
Gene Synonym:KMT7, SET7, SET9, SET7/9, FLJ21193, KIAA1717, SETD7
Species:Human
Vector:pCMV/hygro-HA
Restriction Site:HindIII + XhoI
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HA Vector Information
 
Vector Name pCMV/hygro-HA
Vector Size 5684bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
Schematic of pCMV/hygro-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged on other vectors
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11209-ACG$325
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11209-ACR$325
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11209-ANG$325
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11209-ANR$325
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11209-CF$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11209-CH$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11209-CM$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11209-CY$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone)HG11209-M$195
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11209-M-F$395
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11209-M-N$395
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11209-NF$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11209-NH$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11209-NM$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11209-NY$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11209-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Histone-lysine N-methyltransferase SETD7, also known as SET domain containing (lysine methyltransferase) 7, SET7/9, Histone H3-K4 methyltransferase SETD7, H3-K4-HMTase SETD7, and SETD7, is a member of the histone-lysine methyltransferase family and SET7 subfamily. SETD7 is widely expressed and expressed in pancreatic islets. SETD7 contains three MORN repeats and one SET domain. SETD7 plays a central role in the transcriptional activation of genes such as collagenase or insulin. As a protein lysine methyltransferase (PKMT), SETD7 also has methyltransferase activity toward non-histone proteins such as p53/TP53, TAF10, and possibly TAF7 by recognizing and binding in substrate proteins. The mono-methyltransferase activity of SETD7 is achieved by disrupting the formation at near-attack conformations for the dimethylation reaction. SETD7 is also a novel coactivator of NF-kappaB and plays a role in inflammation and diabetes.

References
  • Wang, H. et al., 2002, Mol Cell 8 (6): 1207-17. 
  • Jacobs, SA. et al., 2002, Nat. Struct. Biol. 9 (11): 833-8. 
  • Xiao B, et al., 2003, Nature. 421 (6923): 652-6.
  • Martens, JH. et al., 2003, Mol. Cell. Biol. 23: 1808-1816.
  • Couture, JF. et al., 2006, Nat Struct Mol Biol  13 (2): 140-6.
  • Size / Price
    Catalog:HG11209-M-Y
    List Price: $395.00  (Save $100.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"