After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CRABP2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Mouse cellular retinoic acid-binding protein 2, also known as Cellular retinoic acid-binding protein II, CRABP-II and CRABP2, is a protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. Cellular retinoic acid binding proteins (CRABP) are low molecular weight proteins whose precise function remains unknown. The predicted amino acid sequences of human CRABP1 and CRABP2 demonstrated a 99.3% and 93.5% identity to mouse CRABP1 and CRABP2, respectively. CRABP2 forms a beta-barrel structure that accommodates hydrophobic ligands in its interior. Expression of CRABP2, but not CRABP1 mRNA, was markedly increased (greater than 15-fold) by retinoic acid treatment of fibroblasts cultured from human skin, whereas no significant induction of CRABP2 mRNA was observed in human lung fibroblasts. CRABP2 transports retinoic acid to the nucleus. It regulates the access of retinoic acid to the nuclear retinoic acid receptors. CRABP2 is necessary for elastin induction by All-trans retinoic acid (ATRA) in MRC-5 cells. It is expressed at low levels in emphysema fibroblasts. This alteration in the retinoic acid signalling pathway in lung fibroblasts may contribute to the defect of alveolar repair in human pulmonary emphysema.

  • Deak, al., 2005,Birth Defects Res A Clin Mol Teratol.73 (11): 868-75.
  • Plantier, L. et al., 2008, Thorax  63 (11): 1012-7.
  • Calmon, M.F. et al., 2009, Neoplasia  11 (12): 1329-39.
  • Welch, I.D. et al., 2009, Arthritis Res Ther  11 (1): R14.
  • Images
    • Human CRABP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items