After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CRABP2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CRABP2cDNA Clone Product Information
cDNA Size:417
cDNA Description:ORF Clone of Homo sapiens cellular retinoic acid binding protein 2 DNA.
Gene Synonym:RBP6, CRABP-II, CRABP2
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CRABP2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged on other vectors
Related Products
Product nameProduct name

Mouse cellular retinoic acid-binding protein 2, also known as Cellular retinoic acid-binding protein II, CRABP-II and CRABP2, is a protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. Cellular retinoic acid binding proteins (CRABP) are low molecular weight proteins whose precise function remains unknown. The predicted amino acid sequences of human CRABP1 and CRABP2 demonstrated a 99.3% and 93.5% identity to mouse CRABP1 and CRABP2, respectively. CRABP2 forms a beta-barrel structure that accommodates hydrophobic ligands in its interior. Expression of CRABP2, but not CRABP1 mRNA, was markedly increased (greater than 15-fold) by retinoic acid treatment of fibroblasts cultured from human skin, whereas no significant induction of CRABP2 mRNA was observed in human lung fibroblasts. CRABP2 transports retinoic acid to the nucleus. It regulates the access of retinoic acid to the nuclear retinoic acid receptors. CRABP2 is necessary for elastin induction by All-trans retinoic acid (ATRA) in MRC-5 cells. It is expressed at low levels in emphysema fibroblasts. This alteration in the retinoic acid signalling pathway in lung fibroblasts may contribute to the defect of alveolar repair in human pulmonary emphysema.

  • Deak, al., 2005,Birth Defects Res A Clin Mol Teratol.73 (11): 868-75.
  • Plantier, L. et al., 2008, Thorax  63 (11): 1012-7.
  • Calmon, M.F. et al., 2009, Neoplasia  11 (12): 1329-39.
  • Welch, I.D. et al., 2009, Arthritis Res Ther  11 (1): R14.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human CRABP2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items