Quick Order

Text Size:AAA

Human MFAP4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
MFAP4cDNA Clone Product Information
Gene Bank Ref.ID:NM_002404.1
cDNA Size:768
cDNA Description:ORF Clone of Homo sapiens microfibrillar-associated protein 4 DNA.
Gene Synonym:MFAP4
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Size / Price
Catalog:HG11195-M-N
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availsability:5 business days
Images
  • Human MFAP4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"