Quick Order

Text Size:AAA

Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRDX1cDNA Clone Product Information
cDNA Size:600
cDNA Description:ORF Clone of Homo sapiens peroxiredoxin 1 DNA.
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged on other vectors
Related Products
Product nameProduct name

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Size / Price
    List Price: $395.00  (Save $100.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items