Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD68 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Macrosialin, also known as CD68 and Gp110, is a single-pass type I  membrane protein which belongs to the LAMP family. CD68 is highly expressed by blood monocytes and tissue macrophages. It is also expressed in lymphocytes, fibroblasts and endothelial cells. CD68 is expressed in many tumor cell lines which could allow them to attach to selectins on vascular endothelium, facilitating their dissemination to secondary sites. CD68 plays a role in phagocytic activities of tissue macrophages, both in intracellular lysosomal metabolism and extracellular cell-cell and cell-pathogen interactions. It is a commonly used marker for macrophages. However, a number of studies have shown that CD68 antibodies react with other hematopoietic and non-hematopoietic cell types, suggesting that CD68 may not be a macrophage-specific antigen. CD68 binds to tissue- and organ-specific lectins or selectins, allowing homing of macrophage subsets to particular sites. Rapid recirculation of CD68 from endosomes and lysosomes to the plasma membrane may allow macrophages to crawl over selectin-bearing substrates or other cells.

  • Strobl H. et al., 1995, Br J Haematol. 90 (4): 774-82.
  • Ogawa Y. et al., 1995, Pathol Int. 45 (9): 698-701.
  • Sadovnikova E. et al., 2002,Leukemia. 16 (10): 2019-26.
  • Gottfried E. et al., 2008, Scand J Immunol. 67 (5): 453-63.
  • Strojnik T. et al., 2009, Anticancer Res. 29 (8): 3269-79.
  • Images
    • Human CD68 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items