After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PARP3 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Loseva O, et al. (2010) PARP-3 is a mono-ADP-ribosylase that activates PARP-1 in the absence of DNA. J Biol Chem. 285(11): 8054-60.
  • Lehtio L, et al. (2009) Structural basis for inhibitor specificity in human poly(ADP-ribose) polymerase-3. J Med Chem. 52(9): 3108-11.
  • Rouleau M, et al. (2009) Assessment of PARP-3 distribution in tissues of cynomolgous monkeys. J Histochem Cytochem. 57(7): 675-85.
  • Rouleau M, et al. (2007) PARP-3 associates with polycomb group bodies and with components of the DNA damage repair machinery. J Cell Biochem. 100(2): 385-401.
  • Augustin A, et al. (2003) PARP-3 localizes preferentially to the daughter centriole and interferes with the G1/S cell cycle progression. J Cell Sci. 116(Pt 8): 1551-62.
  • Images
    • Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items