Quick Order

Text Size:AAA

Human ENTPD5 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ENTPD5 cDNA Clone Product Information
RefSeq ORF Size:1287bp
cDNA Description:Full length Clone DNA of Homo sapiens ectonucleoside triphosphate diphosphohydrolase 5 with Flag tag.
Gene Synonym:PCPH, CD39L4, MGC163357, MGC163359, NTPDase-5, ENTPD5
Restriction Site:HindIII + XhoI (5.4kb + 1.34kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ENTPD5 Gene Plasmid Map
Human ENTPD5 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human ENTPD5 Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human ENTPD5 natural ORF mammalian expression plasmid, Flag tag
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5), also known as CD39 antigen-like 4, ER-UDPase, Guanosine-diphosphatase ENTPD5, Nucleoside diphosphatase Uridine-diphosphatase ENTPD5. This hydrolase is expressed in response to phosphoinositide 3-kinase (PI3K) signaling. Activation of PI3K results in FOXO phosphorylation by AKT1 and loss of ENTPD5 transcriptional repression. It is Up-regulated in PTEN-deficient cells. Uridine diphosphatase (UDPase) that promotes protein N-glycosylation and ATP level regulation.ENTPD5 promotes protein N-glycosylation and folding in the endoplasmic reticulum, as well as elevated ATP consumption in the cytosol via an ATP hydrolysis cycle. Together with CMPK1 and AK1, ENTPD5 constitutes an ATP hydrolysis cycle that converts ATP to AMP and results in a compensatory increase in aerobic glycolysis. ENTPD5 also hydrolyzes GDP and IDP but not any other nucleoside di-, mono- or triphosphates, nor thiamine pyrophosphate. This enzyme Plays a key role in the AKT1-PTEN signaling pathway by promoting glycolysis in proliferating cells in response to phosphoinositide 3-kinase (PI3K) signaling.

  • Villar J, et al. (2009) PCPH/ENTPD5 expression confers to prostate cancer cells resistance against cisplatin-induced apoptosis through protein kinase Calpha-mediated Bcl-2 stabilization. Cancer Res. 69(1): 102-10.
  • Fang M, et al. (2010) The ER UDPase ENTPD5 promotes protein N-glycosylation, the Warburg effect, and proliferation in the PTEN pathway. Cell. 143(5): 711-24.
  • Paez JG, et al. (2001) Identity between the PCPH proto-oncogene and the CD39L4 (ENTPD5) ectonucleoside triphosphate diphosphohydrolase gene. Int J Oncol. 19(6): 1249-54.
  • Size / Price
    Catalog: HG11184-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions