After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NEGR1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NEGR1 cDNA Clone Product Information
RefSeq ORF Size:1065bp
cDNA Description:Full length Clone DNA of Homo sapiens neuronal growth regulator 1 with Flag tag.
Gene Synonym:Ntra, KILON, IGLON4, DMML2433, MGC46680, NEGR1
Restriction Site:HindIII + XbaI (5.5kb + 1.1kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutation 888C/T not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Neuronal Growth Regulator 1, NEGR1, also known as neurotractin, or KILON, which belongs to the immunoglobulin superfamily, IgLON family. This GPI-linked cell surface glycoprotein NEGR1 is composed of three Ig-like domains and belongs to the IgLON subgroup of neural IgSF members. It is expressed in two isoforms with apparent molecular masses of 50 and 37 kD, termed L-form and S-form, respectively. NEGR1/Neurotractin participates in the regulation of neurite outgrowth in the developing brain, and is expressed on neurites of primary hippocampal neurons. Neurotractin/KILON is a trans-neural growth-promoting factor for outgrowing axons following hippocampal denervation. KILON (kindred of IgLON) and opioid-binding cell adhesion molecule belong to the IgLON subgroup of immunoglobulin superfamily together with the limbic system-associated membrane protein and neurotrimin. The alteration of modulatory function of KILON/NEGR1 for the number of dendritic synapses concomitant with changes in its localization and detergent solubility during neuronal culture development. In addition to its reported role in the brain, NEGR1 is also expressed in subcutaneous adipose tissue and acts as a central 'hub' in an obesity-related transcript network.

  • Marg A, et al. (1999) Neurotractin, a novel neurite outgrowth-promoting Ig-like protein that interacts with CEPU-1 and LAMP. J Cell Biol. 145(4): 865-76.
  • Miyata S, et al. (2003) Biochemical and ultrastructural analyses of IgLON cell adhesion molecules, Kilon and OBCAM in the rat brain. Neuroscience. 117(3): 645-58.
  • Schfer M, et al. (2005) Neurotractin/kilon promotes neurite outgrowth and is expressed on reactive astrocytes after entorhinal cortex lesion. Mol Cell Neurosci. 29(4): 580-90.
  • Hashimoto T, et al. (2008) IgLON cell adhesion molecule Kilon is a crucial modulator for synapse number in hippocampal neurons. Brain Res. 1224: 1-11.