Quick Order

Human PLTP transcript variant 1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PLTP cDNA Clone Product Information
RefSeq ORF Size:1482bp
cDNA Description:Full length Clone DNA of Homo sapiens phospholipid transfer protein, transcript variant 1 with Flag tag.
Gene Synonym:HDLCQ9, PLTP
Restriction Site:KpnI + XhoI (5.4kb + 1.53kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PLTP Gene Plasmid Map
Human PLTP transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Phospholipid transfer protein, also known as Lipid transfer protein II and PLTP, is a secreted protein which belongs to the BPI/LBP/Plunc superfamily and BPI / LBP family. PLTP is nearly ubiquitously expressed in cells and tissues. PLTP converts HDL into larger and smaller particles. It may play a key role in extracellular phospholipid transport and modulation of hdl particles. High-density lipoproteins (HDL) play a major protective role against the development of coronary artery disease. PLTP is a main factor regulating the size and composition of HDL in the circulation and plays an important role in controlling plasma HDL levels. This is achieved via both the phospholipid transfer activity of PLTP and its capability to cause HDL conversion. PLTP is one of the key lipid transfer proteins in plasma and cerebrospinal fluid. It is involved in novel intracellular functions. PLTP is an important modulator of lipoprotein metabolism, including interparticle phospholipid transfer, remodeling of HDL, cholesterol and phospholipid efflux from peripheral tissues, and the production of hepatic VLDL. PLTP also plays an important role in inflammation and oxidative stress. Accordingly, PLTP has also been implicated in the development of atherosclerosis.

  • Huuskonen, J. et al., 2000, Atherosclerosis. 151 (2): 451-61.
  • Huuskonen,J. et al., 2001, Atherosclerosis. 155 (2): 269-81.
  • Valenta,D.T. et al., 2008, J Lipid Res. 49 (1): 24-32.
  • Vuletic,S. et al., 2009, Biochim Biophys Acta. 1793 (3): 584-91.
  • Chen, X. et al., 2009, Nutr Metab. 6 : 49.
  • Size / Price
    Catalog: HG11171-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions